Search on : Sequences

 


 
 AY040649
   


Sequence

taagcggaggaaaagaaaccaacagggattgcctcagtaacggcgagtgaagcggcaaaa
gctcaaatttgaaatctggctctttcagggtccgagttgtaatttgtagaagatgctttg
ggtgtggctctggtttaagttctttggaatattacatcatagagggtgagaatcccgtat
gtgaccagtcgccgcgcccgtgtaaagctctttcaacgagtcgagttgtttgggaatgca
gctcaaaatgggaggtatatttcttctaaagctaaatattggccagagaccgatagcgca
caagtagagtgatcgaaagatgaaaagcactttggaaagagagttaaacagtacgtgaaa
ttgttgaaagggaagcgcttgcaaccagacttgcacgcagttgatcatccggtgttctca
ccggggcactctgctgcgttcaggccagcatcccctttggtggttggataaaggccttgg
gaatgtagcttctttcggggagtgttatagcggttttggtgcaatgcagcctaccgggac
cgaggaccgcgcttcggctaggatgctggcgtaatggttgtaagcggcccgtcttgaaac
acggaccaaggagtct


Show reverse-complement sequence

Basics statistics(Total length: 616)
Sequence ChartSequence Chart
Genbank URL:
 
Organism:Antarctic yeast CBS 8931 
Definition:Antarctic yeast CBS 8931 26S ribosomal RNA gene, partial sequence. 
Genbank accession number:AY040649